poly a mrna Search Results


99
New England Biolabs nebnext poly a mrna magnetic isolation module
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Nebnext Poly A Mrna Magnetic Isolation Module, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nebnext poly a mrna magnetic isolation module/product/New England Biolabs
Average 99 stars, based on 1 article reviews
nebnext poly a mrna magnetic isolation module - by Bioz Stars, 2026-04
99/100 stars
  Buy from Supplier

93
TaKaRa mouse poly a selected rna
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Mouse Poly A Selected Rna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse poly a selected rna/product/TaKaRa
Average 93 stars, based on 1 article reviews
mouse poly a selected rna - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
TaKaRa human liver poly a 1 mrna
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Human Liver Poly A 1 Mrna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human liver poly a 1 mrna/product/TaKaRa
Average 93 stars, based on 1 article reviews
human liver poly a 1 mrna - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

94
TaKaRa human brain poly a 1 rna
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Human Brain Poly A 1 Rna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human brain poly a 1 rna/product/TaKaRa
Average 94 stars, based on 1 article reviews
human brain poly a 1 rna - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

92
TaKaRa pituitary glands
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Pituitary Glands, supplied by TaKaRa, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pituitary glands/product/TaKaRa
Average 92 stars, based on 1 article reviews
pituitary glands - by Bioz Stars, 2026-04
92/100 stars
  Buy from Supplier

93
TaKaRa peripheral leukocytes poly a rna clontech
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Peripheral Leukocytes Poly A Rna Clontech, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/peripheral leukocytes poly a rna clontech/product/TaKaRa
Average 93 stars, based on 1 article reviews
peripheral leukocytes poly a rna clontech - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

90
TaKaRa rat brain poly a rna
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Rat Brain Poly A Rna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rat brain poly a rna/product/TaKaRa
Average 90 stars, based on 1 article reviews
rat brain poly a rna - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

93
TaKaRa mouse testis mrna
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Mouse Testis Mrna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse testis mrna/product/TaKaRa
Average 93 stars, based on 1 article reviews
mouse testis mrna - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
TaKaRa human hepg2 cell lines
miR-1301 inhibits the migration of <t>HepG2</t> cells in a scratch test. The scratch test was used to investigate the wound healing ability at 0, 12, 24 and 48 h. We observed that the proliferation and migration ability of HepG2 cells in the wounded area was reduced in the miR-1301 group after a 24 and 48 h repair period when compared with the control group. There was no difference between the miR-1301 transfected and the control group at 12 h.
Human Hepg2 Cell Lines, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human hepg2 cell lines/product/TaKaRa
Average 93 stars, based on 1 article reviews
human hepg2 cell lines - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
TaKaRa rat liver poly a 1 rna
miR-1301 inhibits the migration of <t>HepG2</t> cells in a scratch test. The scratch test was used to investigate the wound healing ability at 0, 12, 24 and 48 h. We observed that the proliferation and migration ability of HepG2 cells in the wounded area was reduced in the miR-1301 group after a 24 and 48 h repair period when compared with the control group. There was no difference between the miR-1301 transfected and the control group at 12 h.
Rat Liver Poly A 1 Rna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rat liver poly a 1 rna/product/TaKaRa
Average 93 stars, based on 1 article reviews
rat liver poly a 1 rna - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
TaKaRa tracheal poly a 1 rna
miR-1301 inhibits the migration of <t>HepG2</t> cells in a scratch test. The scratch test was used to investigate the wound healing ability at 0, 12, 24 and 48 h. We observed that the proliferation and migration ability of HepG2 cells in the wounded area was reduced in the miR-1301 group after a 24 and 48 h repair period when compared with the control group. There was no difference between the miR-1301 transfected and the control group at 12 h.
Tracheal Poly A 1 Rna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tracheal poly a 1 rna/product/TaKaRa
Average 93 stars, based on 1 article reviews
tracheal poly a 1 rna - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

Image Search Results


Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by mRNA signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.

Journal: bioRxiv

Article Title: A Yeast Two-Hybrid Protein Domain Screening Approach for Ebola Virus-Human Protein Interactions Identifies PABPC1 as a Host Factor Required for Replication

doi: 10.64898/2026.03.05.709814

Figure Lengend Snippet: Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by mRNA signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.

Article Snippet: Unidirectional cDNA was prepared from 1 μg of total RNA using the NEBNext® UltraTM Directional RNA Library Prep Kit for Illumina following the “Protocol for use with NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB #E7490)” through step 1.7 (Manual Version 5.0 5/15) with the following changes: 1) poly(A)+ mRNA was eluted for 5 minutes at 65 °C to prevent fragmentation; 2) after synthesizing second strand cDNA, the cDNA was purified using a Zymo Research DNA Clean & Concentrator-5 column (#D4013); 3) the adaptor primer (/5Phos/GATCGGAAGAGCTTGTTCTACCGAGGGACCC/ideoxyU/ ACTACTGCCTAAC GAACTCCCGCTCTTCCGATC*T; * indicates a phosphorothioate bond; synthesized and PAGE purified by IDT) was a modification of the NEBNext Adaptor for Illumina (E7352A).

Techniques: Inhibition, Expressing, Transfection, Negative Control, Infection, Staining, Isolation, Quantitative RT-PCR, SDS Page, Western Blot, Molecular Weight

miR-1301 inhibits the migration of HepG2 cells in a scratch test. The scratch test was used to investigate the wound healing ability at 0, 12, 24 and 48 h. We observed that the proliferation and migration ability of HepG2 cells in the wounded area was reduced in the miR-1301 group after a 24 and 48 h repair period when compared with the control group. There was no difference between the miR-1301 transfected and the control group at 12 h.

Journal: Oncology Reports

Article Title: microRNA-1301-mediated inhibition of tumorigenesis

doi: 10.3892/or.2011.1589

Figure Lengend Snippet: miR-1301 inhibits the migration of HepG2 cells in a scratch test. The scratch test was used to investigate the wound healing ability at 0, 12, 24 and 48 h. We observed that the proliferation and migration ability of HepG2 cells in the wounded area was reduced in the miR-1301 group after a 24 and 48 h repair period when compared with the control group. There was no difference between the miR-1301 transfected and the control group at 12 h.

Article Snippet: Total RNA was extracted from human HepG2 cell lines using TRIzol reagent (Takara Biotechnology Co., Ltd.).

Techniques: Migration, Transfection

miR-1301 inhibits the invasion of HepG2 cells in the Transwell chamber assay. Cell invasion ability was analyzed by the Transwell chamber assay 48 h after miR-1301 transfection. The results showed that the number of migration cells in the miR-1301 group was less than that in control group. This indicated that the invasion ability of HepG2 cells might be inhibited by miR-1301.

Journal: Oncology Reports

Article Title: microRNA-1301-mediated inhibition of tumorigenesis

doi: 10.3892/or.2011.1589

Figure Lengend Snippet: miR-1301 inhibits the invasion of HepG2 cells in the Transwell chamber assay. Cell invasion ability was analyzed by the Transwell chamber assay 48 h after miR-1301 transfection. The results showed that the number of migration cells in the miR-1301 group was less than that in control group. This indicated that the invasion ability of HepG2 cells might be inhibited by miR-1301.

Article Snippet: Total RNA was extracted from human HepG2 cell lines using TRIzol reagent (Takara Biotechnology Co., Ltd.).

Techniques: Transwell Chamber Assay, Transfection, Migration

miR-1301 inhibits cell proliferation. The MTT assay was performed to monitor the proliferation rate of HepG2 cells after miR-1301 transfection. The optical density of each well was measured with a microplate spectrophotometer at 490 nm. The optical density of the miR-1301 group decreased at 24 h (A), 48 h (B), and 72 h (C) after transfection. The proliferation rate of cells decreased with increasing concentrations of inhibitor and increasing transfection time (D).

Journal: Oncology Reports

Article Title: microRNA-1301-mediated inhibition of tumorigenesis

doi: 10.3892/or.2011.1589

Figure Lengend Snippet: miR-1301 inhibits cell proliferation. The MTT assay was performed to monitor the proliferation rate of HepG2 cells after miR-1301 transfection. The optical density of each well was measured with a microplate spectrophotometer at 490 nm. The optical density of the miR-1301 group decreased at 24 h (A), 48 h (B), and 72 h (C) after transfection. The proliferation rate of cells decreased with increasing concentrations of inhibitor and increasing transfection time (D).

Article Snippet: Total RNA was extracted from human HepG2 cell lines using TRIzol reagent (Takara Biotechnology Co., Ltd.).

Techniques: MTT Assay, Transfection, Spectrophotometry

miR-1301 promotes cell apoptosis. Apoptosis of HepG2 cells was observed using fluorescence microscopy through a dual pass filter allowing to visualize the Annexin-V-FITC positive and the propidium iodide positive cells in the same field. The results showed that apoptosis of HepG2 cells increased 48 h after transfection of miR-1301 mimics in the miR-1301 group (Aa) when compared with the control group (Ba). (Aa) Apoptosis cells of the Annexin-V-FITC positive cells in the miR-1301 group; (Ab) cells excited by normal light in the miR-1301 group; (Ba) apoptosis cells of the Annexin-V-FITC positive cells in the control group; (Bb) cells excited by normal light in the control group.

Journal: Oncology Reports

Article Title: microRNA-1301-mediated inhibition of tumorigenesis

doi: 10.3892/or.2011.1589

Figure Lengend Snippet: miR-1301 promotes cell apoptosis. Apoptosis of HepG2 cells was observed using fluorescence microscopy through a dual pass filter allowing to visualize the Annexin-V-FITC positive and the propidium iodide positive cells in the same field. The results showed that apoptosis of HepG2 cells increased 48 h after transfection of miR-1301 mimics in the miR-1301 group (Aa) when compared with the control group (Ba). (Aa) Apoptosis cells of the Annexin-V-FITC positive cells in the miR-1301 group; (Ab) cells excited by normal light in the miR-1301 group; (Ba) apoptosis cells of the Annexin-V-FITC positive cells in the control group; (Bb) cells excited by normal light in the control group.

Article Snippet: Total RNA was extracted from human HepG2 cell lines using TRIzol reagent (Takara Biotechnology Co., Ltd.).

Techniques: Fluorescence, Microscopy, Transfection